circad | circRNAs associated with diseases

hsa_circ_0000190
Gene	CNIH4	Organism	Human
Genome Locus	chr1:224553580-224559125:+	Build	hg19
Disease	Gastric Cancer	ICD-10	Stomach, Malignant neoplasm of unspecified (C16.9)
DBLink	Link to database	PMID	28130019
Experimental Method
Sample Type	Tissues	Comparison	tumor tissue samples and their paired paracancerous histological normal tissues
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward TTGCTCCTTGGGCGCTATAC Reverse AGAGTCCAG CGGCAAAACTA-	Statistics	Fold Change : Downregulated pvalue : p=0.001
Citation
Chen, S, Li, T, Zhao, Q, Xiao, B, Guo, J (2017). Using circular RNA hsa_circ_0000190 as a new biomarker in the diagnosis of gastric cancer. Clin. Chim. Acta, 466:167-171.